The wonderful world of organic substances. The wonderful world of organic substances All carbon-containing substances are classified as organic

Organic matter is a chemical compound that contains carbon. The only exceptions are carbonic acid, carbides, carbonates, cyanides and carbon oxides.

Story

The term “organic substances” itself appeared in the everyday life of scientists at the stage of early development of chemistry. At that time, vitalistic worldviews dominated. This was a continuation of the traditions of Aristotle and Pliny. During this period, pundits were busy dividing the world into living and nonliving. Moreover, all substances without exception were clearly divided into mineral and organic. It was believed that a special “force” was needed to synthesize compounds of “living” substances. It is inherent in all living beings, and without it organic elements cannot be formed.

This is funny for modern science the statement prevailed for a very long time, until in 1828 Friedrich Wöhler experimentally refuted it. He was able to obtain organic urea from inorganic ammonium cyanate. This pushed chemistry forward. However, the division of substances into organic and inorganic has been preserved in the present tense. It forms the basis of classification. Almost 27 million organic compounds are known.

Why are there so many organic compounds?

Organic matter is, with some exceptions, a carbon compound. This is actually a very interesting element. Carbon is capable of forming chains from its atoms. It is very important that the connection between them is stable.

In addition, carbon in organic substances exhibits a valence of IV. It follows from this that this element is capable of forming not only single, but also double and triple bonds with other substances. As their multiplicity increases, the chain consisting of atoms will become shorter. At the same time, the stability of the connection only increases.

Carbon also has the ability to form flat, linear and three-dimensional structures. This is why there are so many different organic substances in nature.

Compound

As mentioned above, organic matter is carbon compounds. And this is very important. arise when it is associated with almost any element of the periodic table. In nature, most often their composition (in addition to carbon) includes oxygen, hydrogen, sulfur, nitrogen and phosphorus. The remaining elements are much less common.

Properties

So, organic matter is a carbon compound. At the same time, there are several important criteria which it must correspond to. All substances of organic origin have common properties:

1. Existing between atoms different typology bonds certainly leads to the appearance of isomers. First of all, they are formed when carbon molecules combine. Isomers are different substances that have one molecular weight and composition, but different chemical and physical properties. This phenomenon is called isomerism.

2. Another criterion is the phenomenon of homology. These are series of organic compounds, in which the formula of neighboring substances differs from the previous ones by one CH 2 group. This important property used in materials science.

What classes of organic substances are there?

Organic compounds include several classes. They are known to everyone. lipids and carbohydrates. These groups can be called biological polymers. They are involved in metabolism at the cellular level in any organism. This group also includes nucleic acids. So we can say that organic matter is what we eat every day, what we are made of.

Squirrels

Proteins are made up of structural components- amino acids. These are their monomers. Proteins are also called proteins. About 200 types of amino acids are known. All of them are found in living organisms. But only twenty of them are components of proteins. They are called basic. But in the literature you can also find less popular terms - proteinogenic and protein-forming amino acids. The formula of an organic substance of this class contains amine (-NH 2) and carboxyl (-COOH) components. They are connected to each other by the same carbon bonds.

Functions of proteins

Proteins in the body of plants and animals perform many important functions. But the main one is structural. Proteins are the main components cell membrane and matrix of organelles in cells. In our body, all the walls of arteries, veins and capillaries, tendons and cartilage, nails and hair consist mainly of different proteins.

The next function is enzymatic. Proteins act as enzymes. They catalyze chemical reactions in the body. They are responsible for the breakdown of nutritional components in the digestive tract. In plants, enzymes fix the position of carbon during photosynthesis.

Some transport various substances in the body, such as oxygen. Organic matter is also capable of attaching to them. This is how the transport function is carried out. Proteins carry metal ions, fatty acids, hormones and, of course, carbon dioxide and hemoglobin through blood vessels. Transport also occurs at the intercellular level.

Protein compounds - immunoglobulins - are responsible for performing a protective function. These are blood antibodies. For example, thrombin and fibrinogen are actively involved in the coagulation process. Thus, they prevent large blood loss.

Proteins are also responsible for performing the contractile function. Due to the fact that myosin and actin protofibrils constantly perform sliding movements relative to each other, muscle fibers contract. But similar processes also occur in single-celled organisms. The movement of bacterial flagella is also directly related to the sliding of microtubules, which are of a protein nature.

The oxidation of organic substances releases large amounts of energy. But, as a rule, proteins are spent on energy needs very rarely. This occurs when all reserves are exhausted. Lipids and carbohydrates are best suited for this. Therefore, proteins can perform an energy function, but only under certain conditions.

Lipids

An organic substance is also a fat-like compound. Lipids belong to the simplest biological molecules. They are insoluble in water, but disintegrate in non-polar solutions such as gasoline, ether and chloroform. They are part of all living cells. Chemically, lipids are alcohols and carboxylic acids. The most famous of them are fats. In the body of animals and plants, these substances perform many important functions. Many lipids are used in medicine and industry.

Functions of lipids

These organic chemicals, together with proteins in cells, form biological membranes. But their main function is energy. When fat molecules are oxidized, a huge amount of energy is released. It goes to the formation of ATP in cells. Significant amounts of energy reserves can be stored in the body in the form of lipids. Sometimes there are even more of them than are needed for normal life activities. At pathological changes the metabolism of “fat” cells increases. Although in fairness it should be noted that such excessive reserves are simply necessary for hibernating animals and plants. Many people believe that trees and shrubs feed on soil during the cold season. In reality, they use up the reserves of oils and fats that they made over the summer.

In the human and animal body, fats can also perform a protective function. They are deposited in the subcutaneous tissue and around organs such as the kidneys and intestines. Thus, they serve as good protection against mechanical damage, that is, impacts.

In addition, fats have a low level of thermal conductivity, which helps retain heat. This is very important, especially in cold climates. In marine animals, the subcutaneous fat layer also contributes to good buoyancy. But in birds, lipids also perform water-repellent and lubricating functions. The wax coats their feathers and makes them more flexible. Some types of plants have the same coating on the leaves.

Carbohydrates

The formula of an organic substance C n (H 2 O) m indicates that the compound belongs to the class of carbohydrates. The name of these molecules refers to the fact that they contain oxygen and hydrogen in the same amount as water. In addition to these chemical elements, compounds may contain, for example, nitrogen.

Carbohydrates in the cell are the main group of organic compounds. These are primary products. They are also the initial products of the synthesis of other substances in plants, for example, alcohols, organic acids and amino acids. Carbohydrates are also found in animal and fungal cells. They are also found among the main components of bacteria and protozoa. Thus, in an animal cell there are from 1 to 2% of them, and in a plant cell their amount can reach 90%.

Today there are only three groups of carbohydrates:

Simple sugars (monosaccharides);

Oligosaccharides, consisting of several molecules of simple sugars connected in series;

Polysaccharides, they contain more than 10 molecules of monosaccharides and their derivatives.

Functions of carbohydrates

All organic substances in the cell perform certain functions. For example, glucose is the main energy source. It is broken down in cells all occurring during cellular respiration. Glycogen and starch constitute the main energy reserves, the former in animals and the latter in plants.

Carbohydrates also perform a structural function. Cellulose is the main component of plant cell walls. And in arthropods, chitin performs the same function. It is also found in the cells of higher fungi. If we take oligosaccharides as an example, they are part of the cytoplasmic membrane - in the form of glycolipids and glycoproteins. Glycocalyx is also often detected in cells. Pentoses are involved in the synthesis of nucleic acids. When is included in DNA, and ribose is included in RNA. These components are also found in coenzymes, for example, FAD, NADP and NAD.

Carbohydrates are also able to perform a protective function in the body. In animals, the substance heparin actively prevents rapid blood clotting. It is formed during tissue damage and blocks the formation of blood clots in blood vessels. Heparin is found in large quantities in mast cells in granules.

Nucleic acids

Proteins, carbohydrates and lipids are not all known classes of organic substances. Chemistry also includes nucleic acids. These are phosphorus-containing biopolymers. They, located in the cell nucleus and cytoplasm of all living beings, ensure the transmission and storage of genetic data. These substances were discovered thanks to the biochemist F. Miescher, who studied salmon sperm. This was an "accidental" discovery. A little later, RNA and DNA were discovered in all plant and animal organisms. Nucleic acids were also isolated in the cells of fungi and bacteria, as well as viruses.

In total, two types of nucleic acids have been found in nature - ribonucleic acids (RNA) and deoxyribonucleic acids (DNA). The difference is clear from the name. deoxyribose is a five-carbon sugar. And ribose is found in the RNA molecule.

Organic chemistry deals with the study of nucleic acids. Topics for research are also dictated by medicine. DNA codes hide many genetic diseases that scientists have yet to discover.

It is known that the properties of organic substances are determined by their composition and chemical structure. Therefore, it is not surprising that the classification of organic compounds is based on the theory of structure - the theory of L. M. Butlerov. Organic substances are classified according to the presence and order of connection of atoms in their molecules. The most durable and least changeable part of an organic substance molecule is its skeleton - a chain of carbon atoms. Depending on the order of connection of carbon atoms in this chain, substances are divided into acyclic, which do not contain closed chains of carbon atoms in molecules, and carbocyclic, which contain such chains (cycles) in molecules.
In addition to carbon and hydrogen atoms, molecules of organic substances can contain atoms of other chemical elements. Substances in whose molecules these so-called heteroatoms are included in a closed chain are classified as heterocyclic compounds.
Heteroatoms (oxygen, nitrogen, etc.) can be part of molecules and acyclic compounds, forming functional groups in them, for example, hydroxyl - OH, carbonyl, carboxyl, amino group -NH2.
Functional group- a group of atoms that determines the most characteristic chemical properties substance and its belonging to a certain class of compounds.

Hydrocarbons- These are compounds consisting only of hydrogen and carbon atoms.

Depending on the structure of the carbon chain, organic compounds are divided into open-chain compounds - acyclic (aliphatic) and cyclic- with a closed chain of atoms.

Cyclic ones are divided into two groups: carbocyclic compounds(cycles are formed only by carbon atoms) and heterocyclic(the cycles also include other atoms, such as oxygen, nitrogen, sulfur).

Carbocyclic compounds, in turn, include two series of compounds: alicyclic and aromatic.

Aromatic compounds, based on the structure of their molecules, have flat carbon-containing rings with a special closed system of p-electrons, forming a common π-system (a single π-electron cloud). Aromaticity is also characteristic of many heterocyclic compounds.

All other carbocyclic compounds belong to the alicyclic series.

Both acyclic (aliphatic) and cyclic hydrocarbons can contain multiple (double or triple) bonds. Such hydrocarbons are called unsaturated (unsaturated) in contrast to saturated (saturated), containing only single bonds.

Saturated aliphatic hydrocarbons called alkanes, they have the general formula C n H 2 n +2, where n is the number of carbon atoms. Their old name is often used today - paraffins.

Containing one double bond, got the name alkenes. They have the general formula C n H 2 n.

Unsaturated aliphatic hydrocarbonswith two double bonds called alkadienes

Unsaturated aliphatic hydrocarbonswith one triple bond called alkynes. Their general formula is C n H 2 n - 2.

Saturated alicyclic hydrocarbons - cycloalkanes, their general formula is C n H 2 n.

A special group of hydrocarbons, aromatic, or arenas(with a closed common π-electron system), known from the example of hydrocarbons with the general formula C n H 2 n -6.

Thus, if their molecules contain one or larger number hydrogen atoms are replaced by other atoms or groups of atoms (halogens, hydroxyl groups, amino groups, etc.), are formed hydrocarbon derivatives: halogen derivatives, oxygen-containing, nitrogen-containing and other organic compounds.

Halogen derivatives hydrocarbons can be considered as products of the substitution of one or more hydrogen atoms in hydrocarbons by halogen atoms. In accordance with this, saturated and unsaturated mono-, di-, tri- (in the general case poly-) halogen derivatives can exist.

General formula of monohalogen derivatives of saturated hydrocarbons:

and the composition is expressed by the formula

C n H 2 n +1 G,

where R is the remainder of a saturated hydrocarbon (alkane), a hydrocarbon radical (this designation is used further when considering other classes of organic substances), G is a halogen atom (F, Cl, Br, I).

Alcohols- derivatives of hydrocarbons in which one or more hydrogen atoms are replaced by hydroxyl groups.

Alcohols are called monatomic, if they have one hydroxyl group, and limiting if they are derivatives of alkanes.

General formula of saturated monohydric alcohols:

and their composition is expressed by the general formula:
C n H 2 n +1 OH or C n H 2 n +2 O

There are known examples of polyhydric alcohols, i.e., those having several hydroxyl groups.

Phenols- derivatives of aromatic hydrocarbons (benzene series), in which one or more hydrogen atoms in the benzene ring are replaced by hydroxyl groups.

The simplest representative with the formula C 6 H 5 OH is called phenol.

Aldehydes and ketones- derivatives of hydrocarbons containing a carbonyl group of atoms (carbonyl).

In aldehyde molecules, one carbonyl bond connects with a hydrogen atom, the other with a hydrocarbon radical.

In the case of ketones, the carbonyl group is bonded to two (generally different) radicals.

The composition of saturated aldehydes and ketones is expressed by the formula C n H 2l O.

Carboxylic acids- hydrocarbon derivatives containing carboxyl groups (-COOH).

If there is one carboxyl group in an acid molecule, then the carboxylic acid is monobasic. General formula of saturated monobasic acids (R-COOH). Their composition is expressed by the formula C n H 2 n O 2.

Ethers are organic substances containing two hydrocarbon radicals connected by an oxygen atom: R-O-R or R 1 -O-R 2.

Radicals can be the same or different. The composition of ethers is expressed by the formula C n H 2 n +2 O

Esters- compounds formed by replacing the hydrogen atom of the carboxyl group in carboxylic acids with a hydrocarbon radical.

Nitro compounds- derivatives of hydrocarbons in which one or more hydrogen atoms are replaced by a nitro group -NO 2.

General formula of saturated mononitro compounds:

and the composition is expressed by the general formula

C n H 2 n +1 NO 2 .

Amines- compounds that are considered to be derivatives of ammonia (NH 3), in which hydrogen atoms are replaced by hydrocarbon radicals.

Depending on the nature of the radical, amines can be aliphaticand aromatic.

Depending on the number of hydrogen atoms replaced by radicals, the following are distinguished:

Primary amines with the general formula: R-NNH 2

Secondary - with the general formula: R 1 -NН-R 2

Tertiary - with the general formula:

In a particular case, secondary and tertiary amines may have the same radicals.

Primary amines can also be considered as derivatives of hydrocarbons (alkanes), in which one hydrogen atom is replaced by an amino group -NH 2. The composition of saturated primary amines is expressed by the formula C n H 2 n +3 N.

Amino acids contain two functional groups connected to a hydrocarbon radical: an amino group -NH 2, and a carboxyl -COOH.

The composition of saturated amino acids containing one amino group and one carboxyl is expressed by the formula C n H 2 n +1 NO 2.

Other important organic compounds are known that have several different or identical functional groups, long linear chains associated with benzene rings. In such cases, a strict determination of whether a substance belongs to a specific class is impossible. These compounds are often classified into specific groups of substances: carbohydrates, proteins, nucleic acids, antibiotics, alkaloids, etc.

To name organic compounds, two nomenclatures are used: rational and systematic (IUPAC) and trivial names.

Compilation of names according to IUPAC nomenclature

1) The basis of the name of the compound is the root of the word, denoting a saturated hydrocarbon with the same number of atoms as the main chain.

2) A suffix is added to the root, characterizing the degree of saturation:

An (ultimate, no multiple connections);
-ene (in the presence of a double bond);
-in (in the presence of a triple bond).

If there are several multiple bonds, then the suffix indicates the number of such bonds (-diene, -triene, etc.), and after the suffix the position of the multiple bond must be indicated in numbers, for example:
CH 3 –CH 2 –CH=CH 2 CH 3 –CH=CH–CH 3
butene-1 butene-2

CH 2 =CH–CH=CH2
butadiene-1,3

Groups such as nitro-, halogens, hydrocarbon radicals that are not included in the main chain are placed in the prefix. They are listed in alphabetical order. The position of the substituent is indicated by the number before the prefix.

The order of naming is as follows:

1. Find the most long chain atoms C.

2. Number the carbon atoms of the main chain sequentially, starting from the end closest to the branch.

3. The name of the alkane is composed of the names of the side radicals, listed in alphabetical order, indicating the position in the main chain, and the name of the main chain.

Nomenclature of some organic substances (trivial and international)

In the past, scientists divided all substances in nature into conditionally non-living and living, including the kingdom of animals and plants among the latter. Substances of the first group are called mineral. And those included in the second began to be called organic substances.

What does this mean? The class of organic substances is the most extensive among all chemical compounds known to modern scientists. The question of what substances are organic can be answered this way - these are chemical compounds that contain carbon.

Please note that not all carbon-containing compounds are organic. For example, corbides and carbonates, carbonic acid and cyanides, and carbon oxides are not included.

Why are there so many organic substances?

The answer to this question lies in the properties of carbon. This element is curious because it is capable of forming chains of its atoms. And at the same time, the carbon bond is very stable.

In addition, in organic compounds it exhibits high valence (IV), i.e. the ability to form chemical bonds with other substances. And not only single, but also double and even triple (otherwise known as multiples). As the bond multiplicity increases, the chain of atoms becomes shorter and the stability of the bond increases.

Carbon is also endowed with the ability to form linear, flat and three-dimensional structures.

This is why organic substances in nature are so diverse. You can easily check this yourself: stand in front of a mirror and look carefully at your reflection. Each of us is a walking manual organic chemistry. Think about it: at least 30% of the mass of each of your cells is organic compounds. Proteins that built your body. Carbohydrates, which serve as “fuel” and a source of energy. Fats that store energy reserves. Hormones that control the functioning of organs and even your behavior. Enzymes that start chemical reactions inside you. And even the “source code”, the DNA chains, are all carbon-based organic compounds.

Composition of organic substances

As we said at the very beginning, the main building material for organic matter is carbon. And practically any element, when combined with carbon, can form organic compounds.

In nature, organic substances most often contain hydrogen, oxygen, nitrogen, sulfur and phosphorus.

Structure of organic substances

The diversity of organic substances on the planet and the diversity of their structure can be explained characteristic features carbon atoms.

You remember that carbon atoms are capable of forming very strong bonds with each other, connecting in chains. The result is stable molecules. Exactly how the carbon atoms are connected in a chain (arranged in a zigzag) is one of the key features its structures. Carbon can be combined into both open chains and closed (cyclic) chains.

It is also important that the structure chemicals directly affects their chemical properties. The way atoms and groups of atoms in a molecule influence each other also plays a significant role.

Due to the structural features, the number of carbon compounds of the same type goes into tens and hundreds. For example, we can consider hydrogen compounds of carbon: methane, ethane, propane, butane, etc.

For example, methane - CH 4. Under normal conditions, such a compound of hydrogen with carbon is in a gaseous state of aggregation. When oxygen appears in the composition, a liquid is formed - methyl alcohol CH 3 OH.

Not only substances with different qualitative compositions (as in the example above) exhibit different properties, but substances of the same qualitative composition are also capable of this. An example is the different ability of methane CH 4 and ethylene C 2 H 4 to react with bromine and chlorine. Methane is capable of such reactions only when heated or exposed to ultraviolet light. And ethylene reacts even without lighting or heating.

Let's consider this option: high-quality composition chemical compounds are the same, quantitative ones are different. Then the chemical properties of the compounds are different. As is the case with acetylene C 2 H 2 and benzene C 6 H 6.

Not the least role in this diversity is played by such properties of organic substances, “tied” to their structure, as isomerism and homology.

Imagine you have two seemingly identical substances—the same composition and the same molecular formula to describe them. But the structure of these substances is fundamentally different, from which follows the difference in chemical and physical properties. For example, molecular formula With 4 H 10 two different substances can be written: butane and isobutane.

It's about isomers– compounds that have the same composition and molecular weight. But the atoms in their molecules are arranged in different orders (branched and unbranched structure).

Regarding homology- this is a characteristic of a carbon chain in which each subsequent member can be obtained by adding one CH 2 group to the previous one. Each homologous series can be expressed by one general formula. And knowing the formula, it is easy to determine the composition of any of the members of the series. For example, homologues of methane are described by the formula C n H 2n+2.

As the “homologous difference” CH 2 increases, the bond between the atoms of the substance strengthens. Let's take the homologous series of methane: its first four members are gases (methane, ethane, propane, butane), the next six are liquids (pentane, hexane, heptane, octane, nonane, decane), and then follow substances in the solid state of aggregation (pentadecane, eicosane, etc.). And the stronger the bond between carbon atoms, the higher the molecular weight, boiling and melting points of substances.

What classes of organic substances exist?

Organic substances of biological origin include:

proteins;
carbohydrates;
nucleic acids;
lipids.

The first three points can also be called biological polymers.

More detailed classification organic chemicals covers substances not only of biological origin.

Hydrocarbons include:

acyclic compounds:
- saturated hydrocarbons (alkanes);
- unsaturated hydrocarbons:
  - alkenes;
  - alkynes;
  - alkadienes.
cyclic connections:
- carbocyclic compounds:
  - alicyclic;
  - aromatic.
- heterocyclic compounds.

There are also other classes of organic compounds in which carbon combines with substances other than hydrogen:

alcohols and phenols;
aldehydes and ketones;
carboxylic acids;
esters;
lipids;
carbohydrates:
- monosaccharides;
- oligosaccharides;
- polysaccharides.
- mucopolysaccharides.
amines;
amino acids;
proteins;
nucleic acids.

Formulas of organic substances by class

Examples of organic substances

As you remember, in the human body various kinds of organic substances are the basis. These are our tissues and fluids, hormones and pigments, enzymes and ATP, and much more.

In the bodies of humans and animals, priority is given to proteins and fats (half of the dry mass of an animal cell is proteins). In plants (approximately 80% of the dry mass of the cell) - carbohydrates, primarily complex ones - polysaccharides. Including cellulose (without which there would be no paper), starch.

Let's talk about some of them in more detail.

For example, about carbohydrates. If it were possible to take and measure the masses of all organic substances on the planet, it would be carbohydrates that would win this competition.

They serve as a source of energy in the body and are building materials for cells, and also store substances. Plants use starch for this purpose, animals use glycogen.

In addition, carbohydrates are very diverse. For example, simple carbohydrates. The most common monosaccharides in nature are pentoses (including deoxyribose, which is part of DNA) and hexoses (glucose, which is familiar to you).

Like bricks, on a large construction site of nature, polysaccharides are built from thousands and thousands of monosaccharides. Without them, more precisely, without cellulose and starch, there would be no plants. And animals without glycogen, lactose and chitin would have a hard time.

Let's look carefully at squirrels. Nature is the greatest master of mosaics and puzzles: from just 20 amino acids, 5 million types of proteins are formed in the human body. Proteins also have many vital functions. For example, construction, regulation of processes in the body, blood clotting (there are separate proteins for this), movement, transport of certain substances in the body, they are also a source of energy, in the form of enzymes they act as a catalyst for reactions, and provide protection. In protecting the body from negative external influences Antibodies play an important role. And if there is a disorder in the fine tuning of the body, antibodies instead of destruction external enemies can act as aggressors to their own organs and tissues of the body.

Proteins are also divided into simple (proteins) and complex (proteids). And they have properties unique to them: denaturation (destruction, which you have noticed more than once when hard-boiling an egg) and renaturation (this property has found wide application in the manufacture of antibiotics, food concentrates, etc.).

Let's not ignore lipids(fats). In our body they serve as a reserve source of energy. As solvents they help biochemical reactions occur. Participate in the construction of the body - for example, in the formation of cell membranes.

And a few more words about such interesting organic compounds as hormones. They participate in biochemical reactions and metabolism. So small, the hormones make men men (testosterone) and women women (estrogen). They make us happy or sad (thyroid hormones play an important role in mood swings, and endorphin gives a feeling of happiness). And they even determine whether we are “night owls” or “larks”. Whether you're willing to study late or prefer to get up early and do your homework before school is determined not only by your daily routine, but also by certain adrenal hormones.

Conclusion

The world of organic matter is truly amazing. It is enough to delve into its study just a little to take your breath away from the feeling of kinship with all life on Earth. Two legs, four or roots instead of legs - we are all united by the magic of Mother Nature's chemical laboratory. It causes carbon atoms to join together in chains, react and create thousands of different chemical compounds.

Now you have a quick guide to organic chemistry. Of course, not all possible information is presented here. You may have to clarify some points yourself. But you can always use the route we have outlined for your own independent research.

You can also use the definition of organic matter, classification and general formulas of organic compounds given in the article and general information about them to prepare for chemistry lessons at school.

Tell us in the comments which section of chemistry (organic or inorganic) do you like best and why. Don't forget to share the article on social networks, so that your classmates can also use it.

Please let me know if you find any inaccuracies or errors in the article. We are all human and we all make mistakes sometimes.

blog.site, when copying material in full or in part, a link to the original source is required.

From Guest >>

1. What is the name of an organic substance whose molecules contain C, O, H atoms that perform an energy and construction function?
A-nucleic acid B-protein
B-carbohydrate G-ATP
2.What carbohydrates are polymers?
A-monosaccharides B-disaccharides C-polysaccharides
3.The group of monosaccharides includes:
A-glucose B-sucrose C-cellulose
4.Which carbohydrates are insoluble in water?
A-glucose, fructose B-starch B-ribose, deoxyribose
5.Fat molecules are formed:
A-from glycerol, higher carboxylic acids B-from glucose
B-from amino acids, water D-from ethyl alcohol, higher carboxylic acids
6.Fats perform the following functions in the cell:
A-transport B-energy
B-catalytic G-information
7.What compounds do lipids belong to in relation to water?
A-hydrophilic B-hydrophobic
8.What is the importance of fats in animals?
A-membrane structure B-thermoregulation
B-source of energy D-source of water D-all of the above
9. Protein monomers are:
A-nucleotides B-amino acids B-glucose G-fats
10. The most important organic substance that is part of the cells of all kingdoms of living nature, which has a primary linear configuration, is:
A to polysaccharides B to lipids
B-to ATP G-to polypeptides
2. Write the functions of proteins, give examples.
3. Task: Based on the DNA chain AATTGCGATGCTTAGTTTAGG, it is necessary to complete the complementary chain and determine the length of the DNA
1. Choose one correct answer
1. How many of the known amino acids are involved in protein synthesis?
A-20 B-100 B-23
2.what part of amino acid molecules distinguishes them from each other?
A-radical B-carboxyl group B-amino group
3. what compounds are included in ATP?
A- adenine, ribose carbohydrate, 3 molecules of phosphoric acid
B- guanine, fructose sugar, phosphoric acid residue.
B-ribose, glycerol and any amino acid
4.What is the role of ATP molecules in the cell?
A-provide transport function B-transmit hereditary information
B-provide vital processes with energy D-accelerate biochemical reactions
5.monomers of nucleic acids are:
A-amino acids B-fats
B-nucleotides G-glucose
6.What class of chemical substances does ribose belong to?
A-protein B-carbohydrate C-lipid
7.Which nucleotide is not included in the DNA molecule?
A-adenylic B-uridylic
B-guanyl G-thymidyl
8.Which of the nucleic acids has greatest length?
A-DNA B-RNA
9.The nucleotide complementary to a guanyl nucleotide is:
A-thymidyl B-cytidyl
B-adenylic G-uridylic
10.The process of doubling DNA molecules is called:
A-replication B-transcription
B-complementarity with G-translation.
2. Write the functions of lipids, give examples.
3. Task. In what sequence will the nucleotides be located in the i-RNA, if the DNA chain has the following composition: GGTATAGCGCTTAAGCCTT, determine the length of the i-RNA.

From Guest >>

1. Choose one correct answer
1. How many of the known amino acids are involved in protein synthesis?
A-20 B-100 B-23
2.what part of amino acid molecules distinguishes them from each other?
A-radical B-carboxyl group B-amino group
3. what compounds are included in ATP?
A- adenine, ribose carbohydrate, 3 molecules of phosphoric acid
B- guanine, fructose sugar, phosphoric acid residue.
B-ribose, glycerol and any amino acid
4.What is the role of ATP molecules in the cell?
A-provide transport function B-transmit hereditary information
B-provide vital processes with energy D-accelerate biochemical reactions
5.monomers of nucleic acids are:
A-amino acids B-fats
B-nucleotides G-glucose
6.What class of chemical substances does ribose belong to?
A-protein B-carbohydrate C-lipid
7.Which nucleotide is not included in the DNA molecule?
A-adenylic B-uridylic
B-guanyl G-thymidyl
8.Which nucleic acid has the longest length?
A-DNA B-RNA
9.The nucleotide complementary to a guanyl nucleotide is:
A-thymidyl B-cytidyl
B-adenylic G-uridylic
10.The process of doubling DNA molecules is called:
A-replication B-transcription
B-complementarity with G-translation.
2. Write the functions of lipids, give examples.
3. Task. In what sequence will the nucleotides be located in the i-RNA, if the DNA chain has the following composition: GGTATAGCGCTTAAGCCTT, determine the length of the i-RNA.